Manual page from htslib
released on June 2018

NAME

faidx – an index enabling random access to FASTA and FASTQ files

SYNOPSIS

file.fa.fai, file.fasta.fai, file.fq.fai, file.fastq.fai

DESCRIPTION

Using an fai index file in conjunction with a FASTA/FASTQ file containing reference sequences enables efficient access to arbitrary regions within those reference sequences. The index file typically has the same filename as the corresponding FASTA/FASTQ file, with .fai appended.

An fai index file is a text file consisting of lines each with five TAB-delimited columns for a FASTA file and six for FASTQ:

NAMEName of this reference sequence
LENGTHTotal length of this reference sequence, in bases
OFFSETOffset in the FASTA/FASTQ file of this sequence's first base
LINEBASESThe number of bases on each line
LINEWIDTHThe number of bytes in each line, including the newline
QUALOFFSETOffset of sequence's first quality within the FASTQ file

The NAME and LENGTH columns contain the same data as would appear in the SN and LN fields of a SAM @SQ header for the same reference sequence.

The OFFSET column contains the offset within the FASTA/FASTQ file, in bytes starting from zero, of the first base of this reference sequence, i.e., of the character following the newline at the end of the header line (the ">" line in FASTA, "@" in FASTQ). Typically the lines of a fai index file appear in the order in which the reference sequences appear in the FASTA/FASTQ file, so .fai files are typically sorted according to this column.

The LINEBASES column contains the number of bases in each of the sequence lines that form the body of this reference sequence, apart from the final line which may be shorter. The LINEWIDTH column contains the number of bytes in each of the sequence lines (except perhaps the final line), thus differing from LINEBASES in that it also counts the bytes forming the line terminator.

The QUALOFFSET works the same way as OFFSET but for the first quality score of this reference sequence. This would be the first character following the newline at the end of the "+" line. For FASTQ files only.

FASTA Files

In order to be indexed with samtools faidx, a FASTA file must be a text file of the form

>name [description...]
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>name [description...]
ATGCATGCATGCAT
GCATGCATGCATGC
[...]

In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be the same length, apart from the final sequence line which may be shorter. (While this sequence line length must be the same within each sequence, it may vary between different reference sequences in the same FASTA file.)

This also means that although the FASTA file may have Unix- or Windows-style or other line termination, the newline characters present must be consistent, at least within each reference sequence.

The samtools implementation uses the first word of the ">" header line text (i.e., up to the first whitespace character, having skipped any initial whitespace after the ">") as the NAME column.

FASTQ Files

FASTQ files for indexing work in the same way as the FASTA files.

@name [description...]
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
+
FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
8011<<
@name [description...]
ATGCATGCATGCAT
GCATGCATGCATGC
+
IIA94445EEII==
=>IIIIIIIIICCC
[...]

Quality lines must be wrapped at the same length as the corresponding sequence lines.

EXAMPLE

For example, given this FASTA file

>one
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>two another chromosome
ATGCATGCATGCAT
GCATGCATGCATGC

formatted with Unix-style (LF) line termination, the corresponding fai index would be

one6653031
two28981415

If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be

one6663032
two281031416

An example FASTQ file

@fastq1
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
+
FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
8011<<
@fastq2
ATGCATGCATGCAT
GCATGCATGCATGC
+
IIA94445EEII==
=>IIIIIIIIICCC

Formatted with Unix-style line termination would give this fai index

fastq1668303179
fastq2281561415188

SEE ALSO

samtools(1)
https://en.wikipedia.org/wiki/FASTA_format

https://en.wikipedia.org/wiki/FASTQ_format

Further description of the FASTA and FASTQ formats