An fai index file is a text file consisting of lines each with five TAB-delimited columns for a FASTA file and six for FASTQ:
| NAME | Name of this reference sequence |
| LENGTH | Total length of this reference sequence, in bases |
| OFFSET | Offset in the FASTA/FASTQ file of this sequence's first base |
| LINEBASES | The number of bases on each line |
| LINEWIDTH | The number of bytes in each line, including the newline |
| QUALOFFSET | Offset of sequence's first quality within the FASTQ file |
The NAME and LENGTH columns contain the same data as would appear in the SN and LN fields of a SAM @SQ header for the same reference sequence.
The OFFSET column contains the offset within the FASTA/FASTQ file, in bytes starting from zero, of the first base of this reference sequence, i.e., of the character following the newline at the end of the header line (the ">" line in FASTA, "@" in FASTQ). Typically the lines of a fai index file appear in the order in which the reference sequences appear in the FASTA/FASTQ file, so .fai files are typically sorted according to this column.
The LINEBASES column contains the number of bases in each of the sequence lines that form the body of this reference sequence, apart from the final line which may be shorter. The LINEWIDTH column contains the number of bytes in each of the sequence lines (except perhaps the final line), thus differing from LINEBASES in that it also counts the bytes forming the line terminator.
The QUALOFFSET works the same way as OFFSET but for the first quality score of this reference sequence. This would be the first character following the newline at the end of the "+" line. For FASTQ files only.
>name
[description...]
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>name
[description...]
ATGCATGCATGCAT
GCATGCATGCATGC
[...]
In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be the same length, apart from the final sequence line which may be shorter. (While this sequence line length must be the same within each sequence, it may vary between different reference sequences in the same FASTA file.)
This also means that although the FASTA file may have Unix- or Windows-style or other line termination, the newline characters present must be consistent, at least within each reference sequence.
The samtools implementation uses the first word of the ">" header line text (i.e., up to the first whitespace character, having skipped any initial whitespace after the ">") as the NAME column.
@name
[description...]
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
+
FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
8011<<
@name
[description...]
ATGCATGCATGCAT
GCATGCATGCATGC
+
IIA94445EEII==
=>IIIIIIIIICCC
[...]
Quality lines must be wrapped at the same length as the corresponding sequence lines.
>one
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>two another chromosome
ATGCATGCATGCAT
GCATGCATGCATGC
formatted with Unix-style (LF) line termination, the corresponding fai index would be
| one | 66 | 5 | 30 | 31 |
| two | 28 | 98 | 14 | 15 |
If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be
| one | 66 | 6 | 30 | 32 |
| two | 28 | 103 | 14 | 16 |
An example FASTQ file
@fastq1
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
+
FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
8011<<
@fastq2
ATGCATGCATGCAT
GCATGCATGCATGC
+
IIA94445EEII==
=>IIIIIIIIICCC
Formatted with Unix-style line termination would give this fai index
| fastq1 | 66 | 8 | 30 | 31 | 79 |
| fastq2 | 28 | 156 | 14 | 15 | 188 |
Further description of the FASTA and FASTQ formats
Copyright © 2025 Genome Research Limited (reg no. 2742969) is a charity registered in England with number 1021457. Terms and conditions.